Go to Top Go to Bottom
Han, Zhang, Gao, Yue, Zhang, Dang, Lan, Chen, and Lei: Y-Single Nucleotide Polymorphisms Diversity in Chinese Indigenous Horse

Abstract

In contrast to high genetic diversity of mitochondrial DNA (mtDNA), equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP) methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs) (Y-45701/997 and Y-50869) and one Y-indel (Y-45288) were identified. Of those, the Y-50869 (T>A) revealed the highest variation frequency (24.67%), whereas it was only 3.29% and 1.97% in Y-45288 (T/-) and Y-45701/997 (G>T) locus, respectively. These three mutations accounted for 27.96% of the total samples and identified five Y-SNP haplotypes, demonstrating genetic diversity of Y chromosome in Chinese horses. In addition, all the five Y-SNP haplotypes were shared by different breeds. Among 13 horse breeds analyzed, Balikun horse displayed the highest nucleotide diversity (π = 5.6×10−4) and haplotype diversity (h = 0.527), while Ningqiang horse showed the lowest nucleotide diversity (π = 0.00000) and haplotype diversity (h = 0.000). The results also revealed that Chinese horses had a different polymorphic pattern of Y chromosome from European and American horses. In conclusion, Chinese horses revealed genetic diversity of Y chromosome, however more efforts should be made to better understand the domestication and paternal origin of Chinese indigenous horses.

INTRODUCTION

As well known, horse is one of the earliest domesticated animals and has played a very significant role in the human civilization (Diamond, 2002; Gupta, 2004; Ludwig et al., 2009). However, when and where it has been domesticated still remains elusive. Archaeological data and coat color variations indicated that horse was probably first domesticated in Eurasian steppe around 5,000 years ago (Ludwig et al., 2009; Outram et al., 2009). In contrast, the mitochondrial DNA (mtDNA) analyses of ancient and modern domestic horses revealed extensive variations within and among breeds, with little congruence of haplogroup distribution to breeds or geographic areas, suggesting that horse had multiple maternal origins (Vilá et al., 2001; Lei et al., 2009; Cieslak et al., 2010). Prezewalski’s horse, the only alive wild horse, was ever deemed the progenitor of the current domestic horses during the process of investigating the origin of domestic horse (Deng et al., 2000; Zhang et al., 2004). Nevertheless, this standpoint was not supported by mtDNA evidence (Ishida et al., 1995; Oakenfull and Ryder, 1998; Oakenfull et al., 2000; Goto et al., 2011) and Y chromosome evidence because two fixed Y chromosome variations were detected in domesticated horses and Prezewalski’s horses (Wallner et al., 2003). The maternal origins of domestic horse is so complicated that more researches were needed to investigate Y chromosome diversity and paternal origins of the domestic horse.
As for China, in which there are very rich genetic resources of domestic animals such as pig, yak, chicken and swamp buffalo (Guo et al., 2006; Liu et al., 2006; Lei et al., 2007; Larson et al., 2010). Furthermore, China is believed to be an important domestication center for domestic animals based on previous publications (Savolainen et al., 2002; Larson et al., 2005; Guo et al., 2006; Liu et al., 2006; Lei et al., 2007). There are 15 local domestic horse breeds and many populations throughout 14 provinces in Northwestern, Southwestern, Northeastern, and Central China (Xie, 1987). Previous studies have proven that China is also a potential domestication center for horse. The mtDNA sequencing analysis of Eastern and European horse populations revealed a higher incidence of haplogroup F and a relatively fewer occurrences of haplogroup D in Eastern populations, while European populations revealed an opposite pattern, suggesting that there has been a degree of genetic isolation and differentiation of Eastern and European horse populations (McGahern et al., 2006), therefore, haplogroup F may have been taken into the domestic gene pool in the Far East (Lei et al., 2009). This viewpoint was further supported by the mtDNA data of ancient horses between 2,000 and 4,000 years ago in China (Cai et al., 2009).
The Y chromosome, because of its male specific feature in the mammalian genome, unpairing with X chromosome during the meiosis, provides a powerful tool to trace the paternal origin of mammals (Skaletsky et al., 2003). Despite most of the studies on Y chromosome in domestic horse revealed no genetic variation (Lindgren et al., 2004; Wallner et al., 2004; Lau et al., 2009; Brandariz-Fontes et al., 2013), a recent study on equine Y chromosome short tandem repeats (Y-STR) detected two Y chromosome haplotypes in Chinese domestic horses (Ling et al., 2010), though, no Y-STR polymorphism was found in horses from Portugal, Spain and France (Brandariz-Fontes et al., 2013), indicating horse Y chromosome is not homogeneous and Chinese horse might display more abundant Y chromosome diversity. In addition, Chinese indigenous horse revealed a higher diversity level in comparison with Spanish horses, German draught horses, Swiss horses, Norwegian horses, Portuguese Sorraia and Friesian horse and Japanese native horse breeds using 27 microsatellite markers (Ling et al., 2011). Recently, a few novel genetic variations on horse Y chromosome were identified by Wallner et al. (2013) that six haplotypes were first found in the European modern horses using high throughput sequencing technology. Of which, haplotype HT1 was the most ancestral with the highest frequency, and the remaining five haplotype were thought to arise on the background of HT1 by mutation or gene conversion after domestication. These polymorphisms have not been verified in Chinese horses and the genetic differences between horses from Europe and China still remain mysterious. Hence, to obtain deeper insights into the Y chromosome diversity, paternal origin and genetic relationship of Chinese domestic horse breeds, this study investigated the genetic diversity of 33 Y-specific loci and found two Y-SNPs and one Y-indel in Chinese domestic horses.

MATERIALS AND METHODS

Specimen collection and DNA extraction

Blood samples of 304 male horses were collected from 13 Chinese domestic breeds distributed in northwestern and southwestern China (Table 1). In addition, two female horses were also collected as negative controls to verify the male specificity of primers used in this study. These 13 breeds can be divided into 5 groups (Xie, 1987) based on their history, ecological environment and body size. The genomic DNA was extracted using a standard phenol-chloroform method (Sambrook and Russell, 2002).

DNA amplification and identification of Y chromosome diversity

A total of 33 pairs of primers were used to investigate the Y-SNPs in Chinese horse breeds (Table 2). Firstly, all the primers used were needed to verify their male specific, which was confirmed by a polymerase chain reaction (PCR) containing two female horse DNA paralleled with two male horse DNA. Subsequently, a total of 15 DNA pools (each pool is 200 μL comprised of 20 individuals) were blended to scan Y-SNPs. The PCR was performed in a 25 μL reaction containing 40 ng pooled genomic DNA, 10 pM each primer, 12.5 μL 2×PCR Mix buffer (including 0.75 U Taq DNA polymerase, 2×PCR buffer, 37.5 μM MgCl2 and 5 μM dNTPs) with the following conditions: 5 min at 95°C, followed by 35 cycles for 30 s at 95°C, 40 s at annealing temperature (Table 2), 30 s at 72°C, a final extension of 10 min at 72°C, at last storing at 4°C. The PCR products from the pooled DNA amplified by 33 pairs of primers were directly sequenced (Shanghai Sangon Biotech Company, Shanghai, China) and the sequences were aligned using DNASTAR 5.0 (DNASTAR, Madison, WI, USA). Those Y chromosome loci of 33 primer pairs (Table 2) suspected to be polymorphic were further genotyped by PCR-restriction fragment length polymorphism (RFLP) if had appropriate restriction enzymes site, otherwise were directly sequenced one by one.
Three Y chromosome loci (Y-45288, Y-50869, and Y-45701/997) were suspected to be polymorphic in above DNA pool sequencing analyses. Among which, an indel found in Y-45288 locus can be distinguished by a TruII restriction enzyme. In the digestion process, 2.5 μL of PCR products were mixed with 5 μL of restriction enzymes buffer (contains 2 U restriction enzymes) and then digested at 65°C for 3 h. Subsequently, digested products were visualized in native polyacrylamide gel electrophoresis. For the Y-50869 and Y-45701/997 locus, polymorphisms in 304 horses were genotyped by direct sequencing.

Data analysis

Haplotype diversity and nucleotide diversity for each breed were estimated using the DnaSPv5 (Librado and Rozas, 2009). A network was constructed to investigate the relationship among haplotypes by Network 4.6.1.1 (Fluxus Technology Ltd., 2012, Kiel, Germany). The polymorphisms in the analyzed segments were exported using MEGA 5.0 (Tamura et al., 2011). Neighbor-joining (NJ) tree with terminal node as breed based on DA was constructed which was evaluated by 1,000 bootstrap (Nei et al., 1972). All positions containing gaps were instead of substitution in the analysis because of insufficient information to construct phylogenetic tree lack of haplotypes with gap.

RESULTS

In current study, we investigated polymorphisms of 33 Y-specific loci among 304 Chinese horses, and for the first time identified two Y-SNPs (in Y-50869 and Y-45701/997) and one Y-indel (in Y-45288). Within the locus Y-45288, only 10 horses harbored a T deletion (3.29%), which can be distinguished by a RFLP method (Figure 1). In locus Y-50869, 75 horses (24.67%) showed an A allele, whereas the remaining 229 horses displayed a T allele at the 264 bp. In the locus Y-45701/997, 298 horses were G allele at position 229 bp, whereas only six horses (1.97%) were T allele (two individuals in Hequ, one individual in Chakouyi, Datong, Yanji and Yushu horse, respectively) (Table 3). In all 13 breeds analyzed, Guanzhong horse revealed the highest mutation frequency in loci Y-45288 and Y-50869 (Table 3).
To further analyze the above three variations of Y chromosome loci, we made a haplotype analysis by combining them together. Hence, a total of five Y-SNP haplotypes (CHT1, CHT2, CHT3, CHT4, and CHT5) were identified (Table 4). And their frequencies among 13 Chinese domestic horse breeds were calculated and presented in Table 5. Among the 13 breeds studied, 12 horse breeds had at least two Y-SNP haplotypes, while Ningqiang breed only had CHT1 haplotype (Table 5). In addition to Guanzhong, Kazakh and Yanji breeds, the CHT1 is a predominant haplotype, consisting of 219 individuals, which accounted for 72.04% of 304 samples. In contrast, the remaining four haplotypes only contained 4, 69, 6 and 6 individuals, respectively (Table 5). The NJ tree based on DA was showed in Figure 2. The dendrogram showed that all five haplotypes could be clustered into two branches. Furthermore, in the first branch haplotype CHT1 and CHT4 gathered together. In the second branch, haplotype CHT2 and haplotype CHT5 gathered firstly, then the haplotype CHT3 was gathered into the branch (Figure 2). All the Y-SNP haplotypes were not restricted to a specific region or breed (Figure 3). The Median-joining (MJ) network showed the relationship among five haplotypes involving relevant breed information. It clearly revealed that CHT1 was in the center position and shared by different breeds, which indicated CHT1 maybe a common and ancestral haplotype (Figure 3). Furthermore, the regional haplotype data clearly demonstrated the increase of genetic variations in a southwest–northwest direction.
The Y-SNP haplotype diversity and nucleotide diversity for each breeds were calculated using software DnaSPv5 (Librado and Rozas, 2009) without considering locus Y-45288, because the DnaSPv5 software cannot distinguish deletion. As shown in Table 6, the average haplotype diversity was 0.402, ranging from 0.000 to 0.527 and the average nucleotide diversity was 0.00044, ranging from 0.00000 to 0.00056. The Balikun and Kazakh horse breeds from Xinjiang autonomous region demonstrated the highest haplotype diversity (h = 0.527 for Balikun; h = 0.523 for Kazakh) and nucleotide diversity (π = 5.6×10−4). In contrast, the Ningqiang horse had the lowest haplotype diversity (h = 0.000) and nucleotide diversity (π = 0.00000). Furthermore, the horse breeds in this study were divided into 5 types, including Mongolia, Southwest, Kazakh, Tibet, and Hequ (Xie, 1987). The results revealed that Mongolia type showed the highest diversity (Table 6). Meanwhile, horses belonging to Mongolia type and Kazakh type also revealed abundant Y chromosome diversity.

DISSCUSSION

Since very limited polymorphism was found on the horse Y chromosome (Lindgren et al., 2004; Wallner et al., 2004; Lau et al., 2009), it has been proposed for a long time that horse was domesticated in a restricted geographical region, resulting in the incorporation of very limited Y chromosome haplotypes into the breeding stock. However, recent studies have observed polymorphisms of Y-STR in Chinese indigenous horses (Ling et al., 2010) and Y-SNPs in European and American horses (Wallner et al., 2013). In current study, we screened polymorphisms of 33 Y chromosome loci in 13 horse breeds, which further indicated that Y chromosome is polymorphic in Chinese horses.
Though the polymorphisms of four loci (Y-25345, Y-45288, Y-50869, and Y-45701/997) have been investigated in European and north American horses (Wallner et al., 2013), the current study found different polymorphic patterns in Chinese horses. First, no polymorphism was detected in locus Y-25345, which showed a substitution of G/A in nine Icelandic horses. Second, Y-indel at locus Y-45288 was 100% linked with Y-SNP T>A at locus Y-50869 in European and north American horses, whereas it is only 60% linked in Chinese horses. Furthermore, to our surprise, a total of 20 SNPs and indels which were identified at the locus Y-45701/997 in 15 Norwegian Fjord horses are absent in Chinese breeds, while only one substitution (G>T) was found (Table 4). The different polymorphic patterns may be caused by the genetic isolation and differentiation between Eastern and Western horse populations, which has been proved in mtDNA analysis (MoGahern et al., 2006; Lei et al., 2009).
The haplotype network (Figure 3) showed that all Y-SNP haplotypes were present in more than one breed, and no haplotype was restricted to a certain region. The constant procurement of horses from many regions by the imperial court, the high mobility of horses and the widely use of horses in wars throughout Chinese history drove the gene flow and mixture of horses from different regions (Xie, 1987), resulting in reduced genetic diversity among horses in different regions.
More than half number of the Guanzhong horse, Kazakh horse and Yanji horse displayed Y chromosome diversity. And the Kazakh horse and Balikun horse breeds displayed the highest haplotype and nucleotide diversity. The Balikun horse, Kazakh horse and Yanji horse breeds distribute in Xinjiang region having vast and widespread grasslands, where large-scale animal husbandry is still sustained. Thus it appears natural that higher genetic diversity is found in horses from Xinjiang. In the distribution region for Kazakh horse, breeding strategy was adopted to reform Kazakh horse performance traits due to the decreasing quality, so that some samples we selected might have undergone the breed proceeding and could be classified as a cultivated breed called Yili horse. Also it is worth noticing that 64% of Yanji horse exhibited CHT3 and 42.67% of the total genetic variation for CHT3 was attributable to Yanji breed which was obtained from Hejing county, Xinjiang region. In 1920s, 11 stallions were imported from Soviet Union’s to ameliorate the local breed quality and their posterities were still distributed in Hejing county, resulting in the high genetic variation in Yanji breed. The Guanzhong horse belongs to cultivated breed which was formed by crossing local mares with imported Carabai and Ardennes stallions primarily (Xie, 1987). This may be an explanation for the higher mutation frequency displayed in Guanzhong horse. On the contrary, no genetic variation was found in Ningqiang horse which displayed the lowest nucleotide and haplotype diversity, consisting with previous mtDNA results (Lei et al., 2009), this could be explained by the recent bottleneck they underwent that resulted in a decrease of its population number and genetic diversity.
From our results, it is obvious that horses from Northwestern China revealed high Y chromosome diversity. Moreover, the mtDNA and Y-STR researches have proved that Chinese native horses preserved much of genetic diversity, particularly in the Southwestern regions (Lei et al., 2009; Ling et al., 2010; 2011). Combining these results, it is credible that Chinese horses exhibit high genetic variation. Archaeological and osteological evidence have, thus far, identified Central Asia as the region where the earliest horse domestication took place, but a lot of efforts on mtDNA found that the domestication of horses was not a single discrete event (McGahern et al., 2006; Cai et al., 2009) and multiple horse domestication events may have occurred later in other regions including China (Lei et al., 2009). Based on our data, we cannot exclude horses possibly to be independently domesticated in China. Meanwhile, this study is not enough to comprehensively understand the paternal origins of Chinese horses. Therefore, more studies on Y chromosome of ancient and modern horses in China are needed in the future.

CONCLUSION

In conclusion, 33 Y chromosome loci were investigated and first detected two Y-SNPs and one Y-indel in Chinese horses, identifying five Y-SNP haplotypes, which suggested that Chinese horse exhibited high genetic diversity and different pattern of genetic variation from European and American horse populations. In order to clarify paternal origins of horse domestication, further studies are required to evaluate the relationship between Chinese horses and horses outside China.

ACKNOWLEDGMENTS

This work was supported by National Natural Science Foundation of China (31072001).

Figure 1
Polymerase chain reaction (PCR) products of Y-45288 locus analyzed by PCR-restriction fragment length polymorphism (RFLP). Individuals with T nucleotide yielded fragments of 91 and 141 bp, while individuals with T deletion only have 232 fragments (Indel, individuals with T deletion; T, individuals with T nucleotide; F, female; -, blank; L, ladder).
ajas-28-8-1066f1.gif
Figure 2
Neighbor-joining tree among 13 horse breeds based on five haplotypes. The number before dash is the haplotype they belong to, the number after dash is the number of individuals.
ajas-28-8-1066f2.gif
Figure 3
A Median-joining (MJ) network calculation of Chinese horse Y chromosome. Colored circles represent sequence haplotypes,, the area being proportional to the frequency of the haplotype in total samples. Branch length is proportional to number of mutations. Different colors represent different horse breed. The network clearly revealed that CHT1 was in the center position, which indicated CHT1 maybe an ancestral haplotype. CDM, Chaidamu; CKY, Chakouyi; DT, Datong; YJ, Yanji; BS, Baise; DB, Debao pony; GUZ, Guanzhong; GZ, Guizhou; NQ, Ningqiang; BLK, Balikun; KZK, Kazakh; YS, Yushu; HQ, Hequ.
ajas-28-8-1066f3.gif
Table 1
Sample information of 13 horse breeds in China
Distribution Breed Abbreviation Sample size Source region
Northwestern China Chaidamu CDM 25 Chaidamu city, Qinghai
Chakouyi CKY 16 Tianzhu county, Gansu
Datong DT 10 Qilian county, Qinghai
Yanji YJ 50 Hejing county, Xinjiang
Balikun BLK 14 Balikun county, Xinjiang
Kazakh KZK 18 Changji city, Xinjiang
Ningqiang NQ 7 Ningqiang county, Shaanxi
Yushu YS 51 Yushu city, Qinghai
Hequ HQ 25 Maqu county, Gansu
Guanzhong GUZ 7 Fufeng county, Shaanxi
Southwestern China Baise BS 40 Baise county, Guangxi
Debao pony DB 19 Debao county, Guangxi
Guizhou GZ 22 Guiyang city, Guizhou
Total 304
Table 2
Detailed information of 33 Y chromosome loci in horse
No. Locus GenBank Primer 5′–3′ Size (bp) Tm (°C) References
1 AMELY-1 AB091794 F: CTGGGTAGGTACAGGGAA
R: ATACTTACGGGCATAGCA
365 56.4 This study
2 AMELY-6 AB091794 F: TTCAGTTCCCACTACCAG
R: CTTGAGCCCAGATTACAG
390 56.4 This study
3 CLY032 BV140826 F: GGTCCAGAATGCCTGAGTAA
R: AGAGACCTTTTGTGGGTGGA
396 64.2 Raudsepp et al. (2004)
4 CLY042 BV140783 F:CAGACCAGAAGCTGAAGAAGAG
R: GGGCTGCATACAAGGAAAGT
331 63.1 Raudsepp et al. (2004)
5 CLY048 BV140835 F: AACAGAACCACTGCACTAAACC
R: CAGATTCCCTTGGCTGACC
358 61 Raudsepp et al. (2004)
6 CLY050 BV140837 F: GCCTCAAGTAGAACCACATCC
R: GCATCCAGAACAGCAAACC
300 64.2 Raudsepp et al. (2004)
7 ETY2 EU687556 F: TAAGGCTTCCCTCCTCCAAT
R: CCAGTGACCCGACATACTGA
850 57.8 Paria et al. (2011)
12 SMCY EU687564 F: AACAGCGAGCCAATGTTTTT
R: GCAAAATTCTGGGAAATCCA
420 57.8 Agulnik et al. (1997)
13 SMCY1 F: TGACAATTTCARRTTTACTCCT
R: CTGTAAAGGTCCAAGATCTT
1000 55 Hellborg and Ellegren (2003)
14 SMCY2 AY532886 F: ATTCCCAATGTGGAGMGGAA
R: CATAGCCACCTTCCTCMAT
300 61 Hellborg and Ellegren (2003)
15 SMCY3 AY532887 F: ATTTACCCTTATGAAATRTTT
R: TCAAATGGGTGWGTGTYACAT
1000 64.2 Hellborg and Ellegren (2003)
16 SMCY5 F: GGTCCCAAGATGATRGGCT
R: AGTTGGGGGGCATRTSAC
200 61.8 Hellborg and Ellegren (2003)
17 SMCY6 F: CTACGGAAGAATCACAGCAG
R: ATTTCAGGAAGSGGTGGYAA
900 64.2 Hellborg and Ellegren (2003)
18 SMCY7 AY532888 F: TGGAGGTGCCCRAARTGTA
R: AACTCTGCAAASTRTACTCCT
400 60.5 Hellborg and Ellegren (2003)
19 SMCY11 F: CTGCCCTGYRCCATGCAT
R: TCCACCTGTTSMAGRACAT
600 56.6 Hellborg and Ellegren (2003)
20 SMCY17 AY532889 F: AATGATCTGTGCAAGTGCTC
R: GTCAAATGACTCAGCYCGAAT
200 55.5 Hellborg and Ellegren (2003)
21 SH3-B-7 BV005719 F: TGAAAGGGCTAATGAACGAT
R: CCTCAGGTTTCGGGATT
436 64.2 Raudsepp et al. (2004)
22 USP9Y EU687569 F: GGTTATGAAATGGTCTCTGC
R: CGAGTCTGTCCATCAGGAGTC
228 60.5 Paria et al. (2011)
23 Y3B1 G72336 F: TGGGTTAATGGGATTTGGTG
R: CAAGCACAGCTCTGTATCAA
508 64.2 Raudsepp et al. (2004)
24 Y3B8 G72337 F: CCCAAGTTCCTTGCCATC
R: AAATTGAAGAGGCCCCAAAG
472 64.2 Raudsepp et al. (2004)
25 Y3B12 G72338 F: GGGAGGCACTGGAAAGTACA
R: GGTGGAGGAATCAGCTGGAG
400 65 Raudsepp et al. (2004)
26 Y3B19 BV005720 F: AAGCCTTTCATGGAAATTGG
R: TTACGCAGACATCCTGGACA
255 56.1 Raudsepp et al. (2004)
27 Y-25345 JX647030 F: CCTCCGGCCTTTATGTCTTAG
R: TTGGGCTGCAGTATACAACG
246 58 Wallner et al. (2013)
28 Y-45288 JX646942 F: CATTTCAGTAACTTCCCTC
R: CGTGAGACACTAGGTTTTA
232 55 This study
29 Y-50869 JX646950 F: GGCCTAAGTTGTTCGCAGAG
R: TGACTGGTGGTGTCCAGTGT
264 58 Wallner et al. (2013)
30 Y-45701/997 JX646942 F: CCAACACACGTCAACAGCTC
R: GGCTTAGGCCACTGATGGTA
444 58 Wallner et al. (2013)
31 ZFY EU687571 F: TGAGCTATGCTGACAAAAGGTG
R: TCTTTCCCTTGTCTTGCTTGA
250 60.5 Paria et al. (2011)
32 ZFY last DQ520652 F: GATGAAGCTAGTATGTATCGG
R: CTAATGTGTGTGTTCTGAATG
666 60.6 Lau et al. (2009)
33 ZFY-ntl DQ520642 F: TAGCAGTTCAAGGATTGCATA 450 50.2 Lau et al. (2009)
Table 3
Allele frequencies of three polymorphic loci in 13 horse breeds
Breed Samples Y-45288 Y-50869 Y-45701/997



T - T A G T
CDM 25 0.9200 0.0800 0.6000 0.4000 1.0000 0.0000
CKY 16 1.0000 0.0000 0.8750 0.1250 0.9375 0.0625
DT 10 0.9000 0.1000 0.9000 0.1000 0.9000 0.1000
YJ 50 1.0000 0.0000 0.3600 0.6400 0.9800 0.0200
BS 40 0.9750 0.0250 0.9250 0.0750 1.0000 0.0000
DB 19 0.9474 0.0526 1.0000 0.0000 1.0000 0.0000
GUZ 7 0.4286 0.5714 0.1429 0.8571 1.0000 0.0000
GZ 22 1.0000 0.0000 0.9545 0.0455 1.0000 0.0000
NQ 7 1.0000 0.0000 1.0000 0.0000 1.0000 0.0000
BLK 14 1.0000 0.0000 0.5714 0.4286 1.0000 0.0000
KZK 18 1.0000 0.0000 0.4444 0.5556 1.0000 0.0000
YS 51 1.0000 0.0000 0.9216 0.0784 0.9804 0.0196
HQ 25 0.9600 0.0400 1.0000 0.0000 0.9200 0.0800
Total 304 0.9671 0.0329 0.7533 0.2467 0.9803 0.0197

CDM, Chaidamu; CKY, Chakouyi; DT, Datong; YJ, Yanji; BLK, Balikun; KZK, Kazakh; NQ, Ningqiang; YS, Yushu; HQ, Hequ; GUZ, Guanzhong; BS, Baise; DB, Debao pony; GZ, Guizhou.

Table 4
The five haplotypes based on three Y chromosme loci
Haplotype Y-45288 Y-50869 Y-45701/997 Percentage (%)
CHT1 T T G 72.04
CHT2 - T G 1.32
CHT3 T A G 22.70
CHT4 T T T 1.97
CHT5 - A G 1.97
Table 5
The frequencies of five Y chromosome haplotypes in 13 Chinese horse breeds
Breed Samples CHT1 CHT2 CHT3 CHT4 CHT5
CDM 25 0.5600 (14) 0.0400 (1) 0.3600 (9) 0.0000 0.0400 (1)
CKY 16 0.8125 (13) 0.0000 0.1250 (2) 0.0625 (1) 0.0000
DT 10 0.8000 (8) 0.0000 0.0000 0.1000 (1) 0.1000 (1)
YJ 50 0.3400 (17) 0.0000 0.6400 (32) 0.0200 (1) 0.0000
BS 40 0.9000 (36) 0.0250 (1) 0.0750 (3) 0.0000 0.0000
DB 19 0.9476 (18) 0.0526 (1) 0.0000 0.0000 0.0000
GUZ 7 0.1429 (1) 0.0000 0.2857 (2) 0.0000 0.5714 (4)
GZ 22 0.9545 (21) 0.0000 0.0455 (1) 0.0000 0.0000
NQ 7 1.0000 (7) 0.0000 0.0000 0.0000 0.0000
BLK 14 0.5714 (8) 0.0000 0.4286 (6) 0.0000 0.0000
KZK 18 0.4444 (8) 0.0000 0.5556 (10) 0.0000 0.0000
YS 51 0.9020 (46) 0.0000 0.0784 (4) 0.0196 (1) 0.0000
HQ 25 0.8800 (22) 0.0400 (1) 0.0000 0.0800 (2) 0.0000
Total 304 0.7204 (219) 0.0132 (4) 0.2270 (69) 0.0197 (6) 0.0197 (6)

CDM, Chaidamu; CKY, Chakouyi; DT, Datong; YJ, Yanji; BS, Baise; DB, Debao pony; GUZ, Guanzhong; GZ, Guizhou; NQ, Ningqiang; BLK, Balikun; KZK, Kazakh; YS, Yushu; HQ, Hequ.

Table 6
Haplotype diversity and nucleotide diversity in 13 horse breeds
Breed Samples K Haplotype diversity (mean±SD) Nucleotide diversity (mean±SD) Type
CDM 25 4 0.500±0.048 0.00053±0.00005 Mongolia
CKY 16 3 0.342±0.140 0.00038±0.00017 h = 0.530, π = 5.9×10−4
DT 10 3 0.378±0.181 0.00043±0.00022
YJ 50 3 0.484±0.047 0.00054±0.00006
BS 40 3 0.142±0.071 0.00015±0.00008 Southwest
DB 19 2 0.000±0.000 0.00000±0.00000 h = 0.190, π = 2.0×10−4
GUZ 7 3 0.286±0.196 0.00030±0.00021
GZ 22 2 0.091±0.081 0.00010±0.00009
NQ 7 1 0.000±0.000 0.00000±0.00000
BLK 14 2 0.527±0.064 0.00056±0.00007 Kazakh
KZK 18 2 0.523±0.048 0.00056±0.00005 h = 0.516, π = 5.5×10−4
YS 51 3 0.184±0.070 0.00020±0.00008 Tibet
HQ 25 3 0.153±0.092 0.00016±0.0001 Hequ
Total 304 5 0.402±0.026 0.00044±0.00003

CDM, Chaidamu; CKY, Chakouyi; DT, Datong; YJ, Yanji; BS, Baise; DB, Debao pony; GUZ, Guanzhong; GZ, Guizhou; NQ, Ningqiang; BLK, Balikun; KZK, Kazakh; YS, Yushu; HQ, Hequ.

K, haplotype numbers; h, haplotype diversity; π, nucleotide diversity.

REFERENCES

Agulnik AI, Bishop CE, Lerner JL, Agulnik SI, Solovyev VV. 1997. Analysis of mutation rates in the SMCY/SMCX genes shows that mammalian evolution is male driven. Mamm Genome 8:134–138.
crossref pmid
Brandariz-Fontes C, Leonard JA, Vega-Pla JL, Backström N, Lindgren G, Lippold S, Rico C. 2013. Y-chromosome analysis in retuertas horses. PloS One 8:5e64985
crossref pmid pmc
Cai D, Tang Z, Han L, Speller CF, Yang DY, Ma X, Cao J, Zhu H, Zhou H. 2009. Ancient DNA provides new insights into the origin of the Chinese domestic horse. J Archaeol Sci 36:835–842.
crossref
Cieslak M, Pruvost M, Benecke N, Hofreiter M, Morales A, Reissmann M, Ludwig A. 2010. Origin and history of mitochondrial DNA lineages in domestic horses. PLoS One 5:12e15311
crossref pmid pmc
Deng T. 2000. Phylogenetic relationship of the Chinese miniature pony to Equus przewalskii (Perissodacatyla, Equidae). Acta Veterinaria et Zootechnica Sinica 31:28–33. (in Chinese)

Diamond J. 2002. Evolution, consequences and future of plant and animal domestication. Nature 418:700–707.
crossref pmid
Excoffier L, Laval G, Schneider S. 2005. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol Bioinform Online 1:47–50.
crossref
Goto H, Ryder OA, Fisher AR, Schultz B, Pond SLK, Nekrutenko A, Makova KD. 2011. A massively parallel sequencing approach uncovers ancient origins and high genetic variability of endangered Przewalski’s horses. Genome Biol Evol 3:1096–1106.
crossref pmid pmc
Guo S, Savolainen P, Su J, Zhang Q, Qi D, Zhou J, Zhong Y, Zhao X, Liu J. 2006. Origin of mitochondrial DNA diversity of domestic yaks. BMC Evol Biol 6:73
crossref pmid pmc
Gupta AK. 2004. Origin of agriculture and domestication of plants and animals linked to early Holocene climate amelioration. Curr Sci 87:54–59.

Hellborg L, Ellegren H. 2003. Y chromosome conserved anchored tagged sequences (YCATS) for the analysis of mammalian male-specific DNA. Mol Ecol 12:283–291.
crossref pmid
Ishida N, Oyunsuren T, Mashima S, Mukoyama H, Saitou N. 1995. Mitochondrial DNA sequences of various species of the genus Equus with special reference to the phylogenetic relationship between Przewalskii’s wild horse and domestic horse. J Mol Evol 41:180–188.
crossref pmid pdf
Larson G, Dobney K, Albarella U, Fang M, Matisoo-Smith E, Robins J, Lowden S, Finlayson H, Brand T, Willerslev E. 2005. Worldwide phylogeography of wild boar reveals multiple centers of pig domestication. Science 307:57151618–1621.
crossref pmid
Larson G, Liu R, Zhao X, Yuan J, Fuller D, Barton L, Dobney K, Fan Q, Gu Z, Liu XH, Luo Y, Lv P, Andersson L, Li N. 2010. Patterns of East Asian pig domestication, migration, and turnover revealed by modern and ancient DNA. Proc Natl Acad Sci USA 107:7686–7691.
crossref pmid pmc
Lau AN, Peng L, Goto H, Chemnick L, Ryder OA, Makova KD. 2009. Horse domestication and conservation genetics of Przewalski’s horse inferred from sex chromosomal and autosomal sequences. Mol Biol Evol 26:199–208.
crossref pmid
Lei CZ, Su R, Bower MA, Edwards CJ, Wang XB, Weining S, Liu L, Xie WM, Li F, Liu RY, Zhang YS, Zhang CM, Chen H. 2009. Multiple maternal origins of native modern and ancient horse populations in China. Anim Genet 40:933–944.
crossref pmid
Lei CZ, Zhang W, Chen H, Lu F, Liu RY, Yang XY, Zhang HC, Liu ZG, Yao LB, Lu ZF, Zhao ZL. 2007. Independent maternal origin of Chinese swamp buffalo (Bubalus bubalis). Anim Genet 38:97–102.
crossref pmid
Librado P, Rozas J. 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451–1452.
crossref pmid
Lindgren G, Backström N, Swinburne J, Hellborg L, Einarsson A, Sandberg K, Cothran G, Vilà C, Binns M, Ellegren H. 2004. Limited number of patrilines in horse domestication. Nat Genet 36:335–336.
crossref pmid
Ling Y, Ma Y, Guan W, Cheng Y, Wang Y, Han J, Jin D, Mang L, Mahmut H. 2010. Identification of Y chromosome genetic variations in Chinese indigenous horse breeds. J Hered 101:639–643.
crossref pmid
Ling YH, Ma YH, Guan WJ, Cheng YJ, Wang YP, Han JL, Mang L, Zhao QJ, He XH, Pu YB, Fu BL. 2011. Evaluation of the genetic diversity and population structure of Chinese indigenous horse breeds using 27 microsatellite markers. Anim Genet 42:56–65.
crossref pmid
Liu YP, Wu GS, Yao YG, Miao YW, Luikart G, Baig M, Beja-Pereira A, Ding ZL, Palanichamy MG, Zhang YP. 2006. Multiple maternal origins of chickens: out of the Asian jungles. Mol Phylogenet Evol 38:12–19.
crossref pmid
Ludwig A, Pruvost M, Reissmann M, Benecke N, Brockmann GA, Castaños P, Cieslak M, Lippold S, Llorente L, Malaspinas AS, Slatkin M, Hofreiter M. 2009. Coat color variation at the beginning of horse domestication. Science 324:5926485–485.
crossref pmid pmc
McGahern A, Bower MAM, Edwards CJ, Brophy PO, Sulimova G, Zakharov I, Vizuete-Forster M, Levine M, Li S, MacHugh DE, Hill EW. 2006. Evidence for biogeographic patterning of mitochondrial DNA sequences in Eastern horse populations. Anim Genet 37:494–497.
crossref pmid
Nei M. 1972. Genetic distance between populations. Am Nat 106:283–292.
crossref
Oakenfull EA, Ryder OA. 1998. Mitochondrial control region and 12S rRNA variation in Przewalski’s horse (Equus przewalskii). Anim Genet 29:456–459.
crossref pmid
Oakenfull EA, Lim HN, Ryder OA. 2000. A survey of equid mitochondrial DNA: Implications for the evolution, genetic diversity and conservation of Equus. Conserv Genet 1:341–355.
crossref
Outram AK, Stear NA, Bendrey R, Olsen S, Kasparov A, Zaibert V, Thorpe N, Evershed RP. 2009. The earliest horse harnessing and milking. Science 323:59191332–1335.
crossref pmid
Raudsepp T, Santani A, Wallner B, Kata SR, Ren C, Zhang HB, Womack JE, Skow LC, Chowdhary BP. 2004. A detailed physical map of the horse Y chromosome. Proc Natl Acad Sci USA 101:9321–9326.
crossref pmid pmc
Paria N, Raudsepp T, Wilkerson AJP, O’Brien PCM, Ferguson-Smith MA, Love CC, Arnold C, Rakestraw P, Murphy WJ, Chowdhary BP. 2011. A gene catalogue of the euchromatic male-specific region of the horse Y chromosome: comparison with human and other mammals. PloS One 6:7e21374
crossref pmid pmc
Sambrook J, Russell DW. 2002. Molecular cloning: A laboratory manual. Huang PT Beijing: Science Press, Beijing, China.

Savolainen P, Zhang YP, Luo J, Lundeberg J, Leitner T. 2002. Genetic evidence for an East Asian origin of domestic dogs. Science 298:55981610–1613.
crossref pmid
Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L, Brown LG, Repping S, Pyntikova T, Ali J, Bieri T, et al. 2003. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423:825–837.
crossref pmid
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739.
crossref pmid pmc
Vilà C, Leonard JA, Götherström A, Marklund S, Sandberg K, Lidén K, Wayne RK, Ellegren H. 2001. Widespread origins of domestic horse lineages. Science 291:5503474–477.
crossref pmid
Wallner B, Brem G, Müller M, Achmann R. 2003. Fixed nucleotide differences on the Y chromosome indicate clear divergence between Equus przewalskii and Equus caballus. Anim Genet 34:453–456.
crossref pmid
Wallner B, Piumi F, Brem G, Müller M, Achmann R. 2004. Isolation of Y chromosome-specific microsatellites in the horse and cross-species amplification in the genus Equus. J Hered 95:158–164.
crossref pmid
Wallner B, Vogl C, Shukla P, Burgstaller JP, Druml T, Brem G. 2013. Identification of genetic variation on the horse Y chromosome and the tracing of male founder lineages in modern breeds. PloS One 8:4e60015
crossref pmid pmc
Xie C. 1987. Chinese Horse Donkey Breeds. Shanghai Science and Technology Press; Shanghai, China: (in Chineses)

Zhang CS. 2004. Wild horses, domestic horses, and center for Eastern Asia horse raising. Agric Archaeol 1:252–254. (in Chinese)

TOOLS
METRICS Graph View
  • 14 Crossref
  • 14 Scopus
  • 14,008 View
  • 94 Download
Related articles


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : animbiosci@gmail.com               

Copyright © 2025 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next